94
|
Addgene inc
targeting α satellite repetitive sequences Targeting α Satellite Repetitive Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+targeting+gfp+sequence/pLKO5%2EsgRNA%2EEFS%2EGFP+(Plasmid+%2357822)/10__1172_slash_jci163325-282-14-25 Average 94 stars, based on 1 article reviews
targeting α satellite repetitive sequences - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
96
|
Addgene inc
sgrna sequence targeting clta Sgrna Sequence Targeting Clta, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+targeting+gfp+sequence/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/us12215361-1930-1-9 Average 96 stars, based on 1 article reviews
sgrna sequence targeting clta - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
90
|
Broad Institute Inc
gfp-targeting or pxpr-515 control sgrna Gfp Targeting Or Pxpr 515 Control Sgrna, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+targeting+gfp+sequence/gfp+targeting+or+pxpr+515+control+sgrna/10__1128_slash_mbio__01530___21-293-6-1 Average 90 stars, based on 1 article reviews
gfp-targeting or pxpr-515 control sgrna - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
96
|
Addgene inc
paper n a pfgh1tut gfp tbk1 targeting sgrna Paper N A Pfgh1tut Gfp Tbk1 Targeting Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+targeting+gfp+sequence/FgH1tUTG+(Plasmid+%2370183)/pm32268090-255-135-130 Average 96 stars, based on 1 article reviews
paper n a pfgh1tut gfp tbk1 targeting sgrna - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
92
|
Addgene inc
sgrna oligo targeting mir 126 ggacggcgcattattactca Sgrna Oligo Targeting Mir 126 Ggacggcgcattattactca, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+targeting+gfp+sequence/pBbB11c-GFP+(Plasmid+%23126126)/pmc05389460-126-0-31 Average 92 stars, based on 1 article reviews
sgrna oligo targeting mir 126 ggacggcgcattattactca - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
90
|
Broad Institute Inc
gfp-targeting sgrna pxpr-011 Gfp Targeting Sgrna Pxpr 011, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+targeting+gfp+sequence/gfp+targeting+sgrna+pxpr+011/pmc08406234-204-6-1 Average 90 stars, based on 1 article reviews
gfp-targeting sgrna pxpr-011 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Broad Institute Inc
sgrna ctrl targeting gfp Sgrna Ctrl Targeting Gfp, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+targeting+gfp+sequence/sgrna+ctrl+targeting+gfp/pm34535664-455-9-24 Average 90 stars, based on 1 article reviews
sgrna ctrl targeting gfp - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
92
|
Addgene inc
sgrna sequences targeting timp 1 Sgrna Sequences Targeting Timp 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+targeting+gfp+sequence/ATF4+10%3A+5%E2%80%99ATF4%2EuORF1%2EGFP+(Plasmid+%2321857)/pm32473126-390-8-42 Average 92 stars, based on 1 article reviews
sgrna sequences targeting timp 1 - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
92
|
Addgene inc
green fluorescent protein gfp targeting sgrna sequences Green Fluorescent Protein Gfp Targeting Sgrna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+targeting+gfp+sequence/lentiCRISPR+-+EGFP+sgRNA+4+(Plasmid+%2351763)/pmc10928094-212-6-14 Average 92 stars, based on 1 article reviews
green fluorescent protein gfp targeting sgrna sequences - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
94
|
Genecopoeia
single guide rnas sgrnas expression clones targeting mfn2 gene Single Guide Rnas Sgrnas Expression Clones Targeting Mfn2 Gene, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+targeting+gfp+sequence/sgRNA%2FCas9+all-in-one+expression+clones+targeting+MFN2/pmc09456763__pnas__2206708119__sapp-233-0-11 Average 94 stars, based on 1 article reviews
single guide rnas sgrnas expression clones targeting mfn2 gene - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
99
|
ATCC
renilla Renilla, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+targeting+gfp+sequence/293T/pmc07033178__41467_2020_14527_MOESM1_ESM-39-30-52 Average 99 stars, based on 1 article reviews
renilla - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
93
|
Addgene inc
transfer plasmid Transfer Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+targeting+gfp+sequence/pLenti-sgRNA+(Plasmid+%2371409)/bio_rxiv__2024__11__06__622207-247-9-31 Average 93 stars, based on 1 article reviews
transfer plasmid - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |