sgrna targeting gfp sequence Search Results


94
Addgene inc targeting α satellite repetitive sequences
Targeting α Satellite Repetitive Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+targeting+gfp+sequence/pLKO5%2EsgRNA%2EEFS%2EGFP+(Plasmid+%2357822)/10__1172_slash_jci163325-282-14-25
Average 94 stars, based on 1 article reviews
targeting α satellite repetitive sequences - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

96
Addgene inc sgrna sequence targeting clta
Sgrna Sequence Targeting Clta, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+targeting+gfp+sequence/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/us12215361-1930-1-9
Average 96 stars, based on 1 article reviews
sgrna sequence targeting clta - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
Broad Institute Inc gfp-targeting or pxpr-515 control sgrna
Gfp Targeting Or Pxpr 515 Control Sgrna, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+targeting+gfp+sequence/gfp+targeting+or+pxpr+515+control+sgrna/10__1128_slash_mbio__01530___21-293-6-1
Average 90 stars, based on 1 article reviews
gfp-targeting or pxpr-515 control sgrna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

96
Addgene inc paper n a pfgh1tut gfp tbk1 targeting sgrna
Paper N A Pfgh1tut Gfp Tbk1 Targeting Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+targeting+gfp+sequence/FgH1tUTG+(Plasmid+%2370183)/pm32268090-255-135-130
Average 96 stars, based on 1 article reviews
paper n a pfgh1tut gfp tbk1 targeting sgrna - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

92
Addgene inc sgrna oligo targeting mir 126 ggacggcgcattattactca
Sgrna Oligo Targeting Mir 126 Ggacggcgcattattactca, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+targeting+gfp+sequence/pBbB11c-GFP+(Plasmid+%23126126)/pmc05389460-126-0-31
Average 92 stars, based on 1 article reviews
sgrna oligo targeting mir 126 ggacggcgcattattactca - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

90
Broad Institute Inc gfp-targeting sgrna pxpr-011
Gfp Targeting Sgrna Pxpr 011, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+targeting+gfp+sequence/gfp+targeting+sgrna+pxpr+011/pmc08406234-204-6-1
Average 90 stars, based on 1 article reviews
gfp-targeting sgrna pxpr-011 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Broad Institute Inc sgrna ctrl targeting gfp
Sgrna Ctrl Targeting Gfp, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+targeting+gfp+sequence/sgrna+ctrl+targeting+gfp/pm34535664-455-9-24
Average 90 stars, based on 1 article reviews
sgrna ctrl targeting gfp - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

92
Addgene inc sgrna sequences targeting timp 1
Sgrna Sequences Targeting Timp 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+targeting+gfp+sequence/ATF4+10%3A+5%E2%80%99ATF4%2EuORF1%2EGFP+(Plasmid+%2321857)/pm32473126-390-8-42
Average 92 stars, based on 1 article reviews
sgrna sequences targeting timp 1 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

92
Addgene inc green fluorescent protein gfp targeting sgrna sequences
Green Fluorescent Protein Gfp Targeting Sgrna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+targeting+gfp+sequence/lentiCRISPR+-+EGFP+sgRNA+4+(Plasmid+%2351763)/pmc10928094-212-6-14
Average 92 stars, based on 1 article reviews
green fluorescent protein gfp targeting sgrna sequences - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

94
Genecopoeia single guide rnas sgrnas expression clones targeting mfn2 gene
Single Guide Rnas Sgrnas Expression Clones Targeting Mfn2 Gene, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+targeting+gfp+sequence/sgRNA%2FCas9+all-in-one+expression+clones+targeting+MFN2/pmc09456763__pnas__2206708119__sapp-233-0-11
Average 94 stars, based on 1 article reviews
single guide rnas sgrnas expression clones targeting mfn2 gene - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

99
ATCC renilla
Renilla, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+targeting+gfp+sequence/293T/pmc07033178__41467_2020_14527_MOESM1_ESM-39-30-52
Average 99 stars, based on 1 article reviews
renilla - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

93
Addgene inc transfer plasmid
Transfer Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+targeting+gfp+sequence/pLenti-sgRNA+(Plasmid+%2371409)/bio_rxiv__2024__11__06__622207-247-9-31
Average 93 stars, based on 1 article reviews
transfer plasmid - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results